Cytochrome c oxidase subunit 7A2, mitochondrial


NameCytochrome c oxidase subunit 7A2, mitochondrial
SynonymsCOX7AL Cytochrome c oxidase subunit VIIa-L Cytochrome c oxidase subunit VIIa-liver/heart Cytochrome c oxidase subunit VIIaL
Gene NameCOX7A2
OrganismHuman
Amino acid sequence
>lcl|BSEQ0008751|Cytochrome c oxidase subunit 7A2, mitochondrial
MLRNLLALRQIGQRTISTASRRHFKNKVPEKQKLFQEDDEIPLYLKGGVADALLYRATMI
LTVGGTAYAIYELAVASFPKKQE
Number of residues83
Molecular Weight9395.89
Theoretical pINone
GO Classification
Functions
    cytochrome-c oxidase activity
Processes
Components
    extracellular exosome
    mitochondrial respiratory chain
General FunctionCytochrome-c oxidase activity
Specific FunctionThis protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport.
Transmembrane Regions
GenBank Protein ID
UniProtKB IDP14406
UniProtKB Entry NameCX7A2_HUMAN
Cellular LocationMitochondrion inner membrane
Gene sequence
>lcl|BSEQ0013394|Cytochrome c oxidase subunit 7A2, mitochondrial (COX7A2)
ATGCATACGCAAGACTCGGAGGTAGTTCCGGTTCCGGCGTGGCCATTTTCGTTGGTGGTG
TTCAGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGCTGCGGAATCTGCTGGCTCTT
CGTCAGATTGGGCAGAGGACGATAAGCACTGCTTCCCGCAGGCATTTTAAAAATAAAGTT
CCGGAGAAGCAAAAACTGTTCCAGGAGGATGATGAAATTCCACTGTATCTAAAGGGTGGG
GTAGCTGATGCCCTCCTGTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATAT
GCCATATATGAGCTGGCTGTGGCTTCATTTCCCAAGAAGCAGGAGTGA
GenBank Gene ID
GeneCard IDNone
GenAtlas ID
HGNC IDHGNC:2288
Chromosome Location6
LocusNone
References
  1. Szklarczyk R, Wanschers BF, Cuypers TD, Esseling JJ, Riemersma M, van den Brand MA, Gloerich J, Lasonder E, van den Heuvel LP, Nijtmans LG, Huynen MA: Iterative orthology prediction uncovers new mitochondrial proteins and identifies C12orf62 as the human ortholog of COX14, a protein involved in the assembly of cytochrome c oxidase. Genome Biol. 2012 Feb 22;13(2):R12. doi: 10.1186/gb-2012-13-2-r12.[22356826 ]
  2. Bian Y, Song C, Cheng K, Dong M, Wang F, Huang J, Sun D, Wang L, Ye M, Zou H: An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. J Proteomics. 2014 Jan 16;96:253-62. doi: 10.1016/j.jprot.2013.11.014. Epub 2013 Nov 22.[24275569 ]
  3. Vaca Jacome AS, Rabilloud T, Schaeffer-Reiss C, Rompais M, Ayoub D, Lane L, Bairoch A, Van Dorsselaer A, Carapito C: N-terminome analysis of the human mitochondrial proteome. Proteomics. 2015 Jul;15(14):2519-24. doi: 10.1002/pmic.201400617. Epub 2015 Jun 8.[25944712 ]
  4. Fabrizi GM, Rizzuto R, Nakase H, Mita S, Lomax MI, Grossman LI, Schon EA: Sequence of a cDNA specifying subunit VIIa of human cytochrome c oxidase. Nucleic Acids Res. 1989 Sep 12;17(17):7107.[2550906 ]
  5. Huttemann M, Muhlenbein N, Schmidt TR, Grossman LI, Kadenbach B: Isolation and sequence of the human cytochrome c oxidase subunit VIIaL gene. Biochim Biophys Acta. 2000 Jun 21;1492(1):252-8.[11004498 ]
  6. Mungall AJ, Palmer SA, Sims SK, Edwards CA, Ashurst JL, Wilming L, Jones MC, Horton R, Hunt SE, Scott CE, Gilbert JG, Clamp ME, Bethel G, Milne S, Ainscough R, Almeida JP, Ambrose KD, Andrews TD, Ashwell RI, Babbage AK, Bagguley CL, Bailey J, Banerjee R, Barker DJ, Barlow KF, Bates K, Beare DM, Beasley H, Beasley O, Bird CP, Blakey S, Bray-Allen S, Brook J, Brown AJ, Brown JY, Burford DC, Burrill W, Burton J, Carder C, Carter NP, Chapman JC, Clark SY, Clark G, Clee CM, Clegg S, Cobley V, Collier RE, Collins JE, Colman LK, Corby NR, Coville GJ, Culley KM, Dhami P, Davies J, Dunn M, Earthrowl ME, Ellington AE, Evans KA, Faulkner L, Francis MD, Frankish A, Frankland J, French L, Garner P, Garnett J, Ghori MJ, Gilby LM, Gillson CJ, Glithero RJ, Grafham DV, Grant M, Gribble S, Griffiths C, Griffiths M, Hall R, Halls KS, Hammond S, Harley JL, Hart EA, Heath PD, Heathcott R, Holmes SJ, Howden PJ, Howe KL, Howell GR, Huckle E, Humphray SJ, Humphries MD, Hunt AR, Johnson CM, Joy AA, Kay M, Keenan SJ, Kimberley AM, King A, Laird GK, Langford C, Lawlor S, Leongamornlert DA, Leversha M, Lloyd CR, Lloyd DM, Loveland JE, Lovell J, Martin S, Mashreghi-Mohammadi M, Maslen GL, Matthews L, McCann OT, McLaren SJ, McLay K, McMurray A, Moore MJ, Mullikin JC, Niblett D, Nickerson T, Novik KL, Oliver K, Overton-Larty EK, Parker A, Patel R, Pearce AV, Peck AI, Phillimore B, Phillips S, Plumb RW, Porter KM, Ramsey Y, Ranby SA, Rice CM, Ross MT, Searle SM, Sehra HK, Sheridan E, Skuce CD, Smith S, Smith M, Spraggon L, Squares SL, Steward CA, Sycamore N, Tamlyn-Hall G, Tester J, Theaker AJ, Thomas DW, Thorpe A, Tracey A, Tromans A, Tubby B, Wall M, Wallis JM, West AP, White SS, Whitehead SL, Whittaker H, Wild A, Willey DJ, Wilmer TE, Wood JM, Wray PW, Wyatt JC, Young L, Younger RM, Bentley DR, Coulson A, Durbin R, Hubbard T, Sulston JE, Dunham I, Rogers J, Beck S: The DNA sequence and analysis of human chromosome 6. Nature. 2003 Oct 23;425(6960):805-11.[14574404 ]
  7. Van Kuilenburg AB, Van Beeumen JJ, Van der Meer NM, Muijsers AO: Subunits VIIa,b,c of human cytochrome c oxidase. Identification of both 'heart-type' and 'liver-type' isoforms of subunit VIIa in human heart. Eur J Biochem. 1992 Jan 15;203(1-2):193-9.[1309697 ]
  8. Burkard TR, Planyavsky M, Kaupe I, Breitwieser FP, Burckstummer T, Bennett KL, Superti-Furga G, Colinge J: Initial characterization of the human central proteome. BMC Syst Biol. 2011 Jan 26;5:17. doi: 10.1186/1752-0509-5-17.[21269460 ]
  9. Ota T, Suzuki Y, Nishikawa T, Otsuki T, Sugiyama T, Irie R, Wakamatsu A, Hayashi K, Sato H, Nagai K, Kimura K, Makita H, Sekine M, Obayashi M, Nishi T, Shibahara T, Tanaka T, Ishii S, Yamamoto J, Saito K, Kawai Y, Isono Y, Nakamura Y, Nagahari K, Murakami K, Yasuda T, Iwayanagi T, Wagatsuma M, Shiratori A, Sudo H, Hosoiri T, Kaku Y, Kodaira H, Kondo H, Sugawara M, Takahashi M, Kanda K, Yokoi T, Furuya T, Kikkawa E, Omura Y, Abe K, Kamihara K, Katsuta N, Sato K, Tanikawa M, Yamazaki M, Ninomiya K, Ishibashi T, Yamashita H, Murakawa K, Fujimori K, Tanai H, Kimata M, Watanabe M, Hiraoka S, Chiba Y, Ishida S, Ono Y, Takiguchi S, Watanabe S, Yosida M, Hotuta T, Kusano J, Kanehori K, Takahashi-Fujii A, Hara H, Tanase TO, Nomura Y, Togiya S, Komai F, Hara R, Takeuchi K, Arita M, Imose N, Musashino K, Yuuki H, Oshima A, Sasaki N, Aotsuka S, Yoshikawa Y, Matsunawa H, Ichihara T, Shiohata N, Sano S, Moriya S, Momiyama H, Satoh N, Takami S, Terashima Y, Suzuki O, Nakagawa S, Senoh A, Mizoguchi H, Goto Y, Shimizu F, Wakebe H, Hishigaki H, Watanabe T, Sugiyama A, Takemoto M, Kawakami B, Yamazaki M, Watanabe K, Kumagai A, Itakura S, Fukuzumi Y, Fujimori Y, Komiyama M, Tashiro H, Tanigami A, Fujiwara T, Ono T, Yamada K, Fujii Y, Ozaki K, Hirao M, Ohmori Y, Kawabata A, Hikiji T, Kobatake N, Inagaki H, Ikema Y, Okamoto S, Okitani R, Kawakami T, Noguchi S, Itoh T, Shigeta K, Senba T, Matsumura K, Nakajima Y, Mizuno T, Morinaga M, Sasaki M, Togashi T, Oyama M, Hata H, Watanabe M, Komatsu T, Mizushima-Sugano J, Satoh T, Shirai Y, Takahashi Y, Nakagawa K, Okumura K, Nagase T, Nomura N, Kikuchi H, Masuho Y, Yamashita R, Nakai K, Yada T, Nakamura Y, Ohara O, Isogai T, Sugano S: Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 2004 Jan;36(1):40-5. Epub 2003 Dec 21.[14702039 ]
  10. Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7.[15489334 ]

Related FRC


FRCD ID Name Exact Mass Structure



Phosphine




33.998



Methanol




32.042



Linamarin




247.247



Acetonitrile




41.053



Mandelonitrile




133.15



Acrylonitrile




53.064



Beta-Aminopropionitrile




70.095



Benzonitrile




103.124



Benzeneacetonitrile




117.151



Bromoxynil




276.915



Chlorfenapyr




407.615



Chlorothalonil




265.902



2,6-Dichlorobenzonitrile




172.008



Cyanide




26.018



Zinc phosphide




264.136