Metallothionein-3


NameMetallothionein-3
SynonymsGIF GIFB Growth inhibitory factor Metallothionein-III MT-3 MT-III
Gene NameMT3
OrganismHuman
Amino acid sequence
>lcl|BSEQ0017834|Metallothionein-3
MDPETCPCPSGGSCTCADSCKCEGCKCTSCKKSCCSCCPAECEKCAKDCVCKGGEAAEAE
AEKCSCCQ
Number of residues68
Molecular Weight6926.855
Theoretical pINone
GO Classification
Functions
    antioxidant activity
    cysteine-type endopeptidase inhibitor activity involved in apoptotic process
    cadmium ion binding
    drug binding
    zinc ion binding
    protein kinase activator activity
    copper ion binding
Processes
    brain development
    cellular metal ion homeostasis
    cellular response to oxidative stress
    positive regulation of ERK1 and ERK2 cascade
    negative regulation of cysteine-type endopeptidase activity
    negative regulation of cell growth
    positive regulation of protein phosphorylation
    negative regulation of oxidoreductase activity
    cellular response to hypoxia
    negative regulation of hydrogen peroxide catabolic process
    positive regulation of transcription, DNA-templated
    regulation of response to food
    positive regulation of cell death
    negative regulation of necrotic cell death
    activation of protein kinase B activity
    negative regulation of apoptotic process
    cellular response to cadmium ion
    cellular response to drug
    astrocyte development
    positive regulation of lysosomal membrane permeability
    removal of superoxide radicals
    protein import into nucleus, translocation
    negative regulation of cysteine-type endopeptidase activity involved in apoptotic process
    negative regulation of axon extension
    positive regulation of gene expression
    cellular lipid catabolic process
    positive regulation of oxygen metabolic process
    cellular response to nitric oxide
    response to hypoxia
    cholesterol catabolic process
    negative regulation of neuron apoptotic process
    negative regulation of reactive oxygen species metabolic process
    ERK1 and ERK2 cascade
    positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress
    energy reserve metabolic process
    cellular zinc ion homeostasis
    positive regulation of necrotic cell death
    negative regulation of autophagy
    regulation of protein glycosylation
    cell proliferation
    positive regulation of vascular endothelial growth factor receptor signaling pathway
    positive regulation of catalytic activity
    zinc II ion transport
    protein kinase B signaling
    protein stabilization
    zinc ion homeostasis
    histone modification
    cadmium ion homeostasis
    negative regulation of transcription, DNA-templated
    leptin-mediated signaling pathway
Components
    rough endoplasmic reticulum
    ribosome
    microtubule
    plasma membrane
    extracellular space
    synaptic vesicle
    dendritic spine
    postsynaptic density
    intracellular
    inclusion body
    mitochondrial outer membrane
    astrocyte end-foot
    cytoplasm
    axon
    perinuclear region of cytoplasm
General FunctionZinc ion binding
Specific FunctionBinds heavy metals. Contains three zinc and three copper atoms per polypeptide chain and only a negligible amount of cadmium. Inhibits survival and neurite formation of cortical neurons in vitro.
Transmembrane Regions
GenBank Protein ID
UniProtKB IDP25713
UniProtKB Entry NameMT3_HUMAN
Cellular LocationNone
Gene sequence
>lcl|BSEQ0017835|Metallothionein-3 (MT3)
ATGGACCCTGAGACCTGCCCCTGCCCTTCTGGTGGCTCCTGCACCTGCGCGGACTCCTGC
AAGTGCGAGGGATGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGCG
GAGTGTGAGAAGTGTGCCAAGGACTGTGTGTGCAAAGGCGGAGAGGCAGCTGAGGCAGAA
GCAGAGAAGTGCAGCTGCTGCCAGTGA
GenBank Gene ID
GeneCard IDNone
GenAtlas ID
HGNC IDHGNC:7408
Chromosome Location16
LocusNone
References
  1. Uchida Y, Takio K, Titani K, Ihara Y, Tomonaga M: The growth inhibitory factor that is deficient in the Alzheimer's disease brain is a 68 amino acid metallothionein-like protein. Neuron. 1991 Aug;7(2):337-47.[1873033 ]
  2. Palmiter RD, Findley SD, Whitmore TE, Durnam DM: MT-III, a brain-specific member of the metallothionein gene family. Proc Natl Acad Sci U S A. 1992 Jul 15;89(14):6333-7.[1631128 ]
  3. Tsuji S, Kobayashi H, Uchida Y, Ihara Y, Miyatake T: Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 1992 Dec;11(13):4843-50.[1464312 ]
  4. Naruse S, Igarashi S, Furuya T, Kobayashi H, Miyatake T, Tsuji S: Structures of the human and mouse growth inhibitory factor-encoding genes. Gene. 1994 Jul 8;144(2):283-7.[8039715 ]
  5. Amoureux MC, Wurch T, Pauwels PJ: Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem Biophys Res Commun. 1995 Sep 14;214(2):639-45.[7677777 ]
  6. Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7.[15489334 ]

Related FRC


FRCD ID Name Exact Mass Structure



Cadmium




112.414



Zinc




65.38



Copper




63.546



Melatonin




232.283