Metallothionein-3
| Name | Metallothionein-3 |
|---|---|
| Synonyms | GIF GIFB Growth inhibitory factor Metallothionein-III MT-3 MT-III |
| Gene Name | MT3 |
| Organism | Human |
| Amino acid sequence | >lcl|BSEQ0017834|Metallothionein-3 MDPETCPCPSGGSCTCADSCKCEGCKCTSCKKSCCSCCPAECEKCAKDCVCKGGEAAEAE AEKCSCCQ |
| Number of residues | 68 |
| Molecular Weight | 6926.855 |
| Theoretical pI | None |
| GO Classification |
Functions
antioxidant activity cysteine-type endopeptidase inhibitor activity involved in apoptotic process cadmium ion binding drug binding zinc ion binding protein kinase activator activity copper ion binding Processes
brain development cellular metal ion homeostasis cellular response to oxidative stress positive regulation of ERK1 and ERK2 cascade negative regulation of cysteine-type endopeptidase activity negative regulation of cell growth positive regulation of protein phosphorylation negative regulation of oxidoreductase activity cellular response to hypoxia negative regulation of hydrogen peroxide catabolic process positive regulation of transcription, DNA-templated regulation of response to food positive regulation of cell death negative regulation of necrotic cell death activation of protein kinase B activity negative regulation of apoptotic process cellular response to cadmium ion cellular response to drug astrocyte development positive regulation of lysosomal membrane permeability removal of superoxide radicals protein import into nucleus, translocation negative regulation of cysteine-type endopeptidase activity involved in apoptotic process negative regulation of axon extension positive regulation of gene expression cellular lipid catabolic process positive regulation of oxygen metabolic process cellular response to nitric oxide response to hypoxia cholesterol catabolic process negative regulation of neuron apoptotic process negative regulation of reactive oxygen species metabolic process ERK1 and ERK2 cascade positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress energy reserve metabolic process cellular zinc ion homeostasis positive regulation of necrotic cell death negative regulation of autophagy regulation of protein glycosylation cell proliferation positive regulation of vascular endothelial growth factor receptor signaling pathway positive regulation of catalytic activity zinc II ion transport protein kinase B signaling protein stabilization zinc ion homeostasis histone modification cadmium ion homeostasis negative regulation of transcription, DNA-templated leptin-mediated signaling pathway Components
rough endoplasmic reticulum ribosome microtubule plasma membrane extracellular space synaptic vesicle dendritic spine postsynaptic density intracellular inclusion body mitochondrial outer membrane astrocyte end-foot cytoplasm axon perinuclear region of cytoplasm |
| General Function | Zinc ion binding |
| Specific Function | Binds heavy metals. Contains three zinc and three copper atoms per polypeptide chain and only a negligible amount of cadmium. Inhibits survival and neurite formation of cortical neurons in vitro. |
| Transmembrane Regions | |
| GenBank Protein ID | |
| UniProtKB ID | P25713 |
| UniProtKB Entry Name | MT3_HUMAN |
| Cellular Location | None |
| Gene sequence | >lcl|BSEQ0017835|Metallothionein-3 (MT3) ATGGACCCTGAGACCTGCCCCTGCCCTTCTGGTGGCTCCTGCACCTGCGCGGACTCCTGC AAGTGCGAGGGATGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGCG GAGTGTGAGAAGTGTGCCAAGGACTGTGTGTGCAAAGGCGGAGAGGCAGCTGAGGCAGAA GCAGAGAAGTGCAGCTGCTGCCAGTGA |
| GenBank Gene ID | |
| GeneCard ID | None |
| GenAtlas ID | |
| HGNC ID | HGNC:7408 |
| Chromosome Location | 16 |
| Locus | None |
| References |
|
Related FRC
| FRCD ID | Name | Exact Mass | Structure |
|---|---|---|---|
Cadmium |
112.414 |
||
Zinc |
65.38 |
||
Copper |
63.546 |
||
Melatonin |
232.283 |