Metallothionein-3

NameMetallothionein-3
SynonymsGIF GIFB Growth inhibitory factor Metallothionein-III MT-3 MT-III
Gene NameMT3
OrganismHuman
Amino acid sequence
>lcl|BSEQ0017834|Metallothionein-3
MDPETCPCPSGGSCTCADSCKCEGCKCTSCKKSCCSCCPAECEKCAKDCVCKGGEAAEAE
AEKCSCCQ
Number of residues68
Molecular Weight6926.855
Theoretical pINone
GO Classification
Functions
    antioxidant activity
cysteine-type endopeptidase inhibitor activity involved in apoptotic process
cadmium ion binding
drug binding
zinc ion binding
protein kinase activator activity
copper ion binding
Processes
    brain development
cellular metal ion homeostasis
cellular response to oxidative stress
positive regulation of ERK1 and ERK2 cascade
negative regulation of cysteine-type endopeptidase activity
negative regulation of cell growth
positive regulation of protein phosphorylation
negative regulation of oxidoreductase activity
cellular response to hypoxia
negative regulation of hydrogen peroxide catabolic process
positive regulation of transcription, DNA-templated
regulation of response to food
positive regulation of cell death
negative regulation of necrotic cell death
activation of protein kinase B activity
negative regulation of apoptotic process
cellular response to cadmium ion
cellular response to drug
astrocyte development
positive regulation of lysosomal membrane permeability
removal of superoxide radicals
protein import into nucleus, translocation
negative regulation of cysteine-type endopeptidase activity involved in apoptotic process
negative regulation of axon extension
positive regulation of gene expression
cellular lipid catabolic process
positive regulation of oxygen metabolic process
cellular response to nitric oxide
response to hypoxia
cholesterol catabolic process
negative regulation of neuron apoptotic process
negative regulation of reactive oxygen species metabolic process
ERK1 and ERK2 cascade
positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress
energy reserve metabolic process
cellular zinc ion homeostasis
positive regulation of necrotic cell death
negative regulation of autophagy
regulation of protein glycosylation
cell proliferation
positive regulation of vascular endothelial growth factor receptor signaling pathway
positive regulation of catalytic activity
zinc II ion transport
protein kinase B signaling
protein stabilization
zinc ion homeostasis
histone modification
cadmium ion homeostasis
negative regulation of transcription, DNA-templated
leptin-mediated signaling pathway
Components
    rough endoplasmic reticulum
ribosome
microtubule
plasma membrane
extracellular space
synaptic vesicle
dendritic spine
postsynaptic density
intracellular
inclusion body
mitochondrial outer membrane
astrocyte end-foot
cytoplasm
axon
perinuclear region of cytoplasm
General FunctionZinc ion binding
Specific FunctionBinds heavy metals. Contains three zinc and three copper atoms per polypeptide chain and only a negligible amount of cadmium. Inhibits survival and neurite formation of cortical neurons in vitro.
Transmembrane Regions
GenBank Protein ID
UniProtKB IDP25713
UniProtKB Entry NameMT3_HUMAN
Cellular LocationNone
Gene sequence
>lcl|BSEQ0017835|Metallothionein-3 (MT3)
ATGGACCCTGAGACCTGCCCCTGCCCTTCTGGTGGCTCCTGCACCTGCGCGGACTCCTGC
AAGTGCGAGGGATGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGCG
GAGTGTGAGAAGTGTGCCAAGGACTGTGTGTGCAAAGGCGGAGAGGCAGCTGAGGCAGAA
GCAGAGAAGTGCAGCTGCTGCCAGTGA
GenBank Gene ID
GeneCard IDNone
GenAtlas ID
HGNC IDHGNC:7408
Chromosome Location16
LocusNone
References
  1. Uchida Y, Takio K, Titani K, Ihara Y, Tomonaga M: The growth inhibitory factor that is deficient in the Alzheimer's disease brain is a 68 amino acid metallothionein-like protein. Neuron. 1991 Aug;7(2):337-47.[1873033 ]
  2. Palmiter RD, Findley SD, Whitmore TE, Durnam DM: MT-III, a brain-specific member of the metallothionein gene family. Proc Natl Acad Sci U S A. 1992 Jul 15;89(14):6333-7.[1631128 ]
  3. Tsuji S, Kobayashi H, Uchida Y, Ihara Y, Miyatake T: Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 1992 Dec;11(13):4843-50.[1464312 ]
  4. Naruse S, Igarashi S, Furuya T, Kobayashi H, Miyatake T, Tsuji S: Structures of the human and mouse growth inhibitory factor-encoding genes. Gene. 1994 Jul 8;144(2):283-7.[8039715 ]
  5. Amoureux MC, Wurch T, Pauwels PJ: Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem Biophys Res Commun. 1995 Sep 14;214(2):639-45.[7677777 ]
  6. Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7.[15489334 ]

Related FRC

FRCD ID Name Exact Mass Structure




F04778



Melatonin


232.283




F03272



Cadmium


112.414




F03327



Zinc


65.38




F03371



Copper


63.546